hyraxAbif: Modules for parsing, generating and manipulating AB1 files.

[ ab1, abif, bioinformatics, chromatogram, library, program ] [ Propose Tags ]

This library provides functionality for parsing, modifying, writing and generating ABIF files

Any AB1 file conforming to the standard at http://www6.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf should be supported.

This library also support generating a minimal ABIF file from a FASTA input sequence.

A basic terminal application that can dump and generate AB1s is included. See https://github.com/hyraxbio/hyraxAbif/blob/master/app/Main.hs

See


[Skip to Readme]

Downloads

Note: This package has metadata revisions in the cabal description newer than included in the tarball. To unpack the package including the revisions, use 'cabal get'.

Maintainer's Corner

Package maintainers

For package maintainers and hackage trustees

Candidates

Versions [RSS] 0.2.3.2, 0.2.3.3, 0.2.3.4, 0.2.3.5, 0.2.3.7, 0.2.3.8, 0.2.3.9, 0.2.3.10, 0.2.3.14, 0.2.3.15, 0.2.3.21, 0.2.3.26, 0.2.3.27, 0.2.4.2, 0.2.4.4, 0.2.4.5
Dependencies base (>=4.9.1.0 && <5), binary (>=0.8.5.1 && <0.8.8.0), bytestring (>=0.10.8.2 && <0.10.11.0), directory (>=1.3.0.2 && <1.3.7.0), filepath (>=1.4.1.2 && <1.4.3.0), hscolour (>=1.24.4 && <1.25.0), hyraxAbif, pretty-show (>=1.6.16 && <1.10.0), protolude (>=0.2.2 && <0.3.1), text (>=1.2.3.0 && <1.2.5.0) [details]
License (BSD-3-Clause OR Apache-2.0)
Copyright 2018-2020 HyraxBio
Author HyraxBio
Maintainer andre@hyraxbio.co.za
Revised Revision 3 made by andrevdm at 2020-05-21T06:08:01Z
Category Bioinformatics
Home page https://github.com/hyraxbio/hyraxAbif/#readme
Source repo head: git clone https://github.com/hyraxbio/hyraxAbif
Uploaded by andrevdm at 2020-02-11T09:42:54Z
Distributions LTSHaskell:0.2.4.5
Reverse Dependencies 1 direct, 0 indirect [details]
Executables hyraxAbif-exe
Downloads 5706 total (38 in the last 30 days)
Rating (no votes yet) [estimated by Bayesian average]
Your Rating
  • λ
  • λ
  • λ
Status Docs available [build log]
Last success reported on 2020-02-11 [all 1 reports]

Readme for hyraxAbif-0.2.3.21

[back to package description]

HyraxBio AB1 parser, writer and generator (beta 0.2)

This project contains

  • Modules for parsing, generating or manipulating AB1 files.
  • Support for generating a minimal AB1 file from a FASTA input file
  • A simple terminal app to perform these operations

See

Licence

See the LICENCE file. Please note that this package is distributed *without warranties or conditions of any kind.

Building

Build with one of

  • stack build or (make build)
  • cabal new-build

Terminal app

Run with

  • stack exec hyraxAbif-exe -- -- dump if you are using stack
  • cabal new-run hyraxAbif-exe dump if you are using cabal 2.x

Dump AB1

To dump an existing AB1 run

hyraxAbif-exe dump example.ab1

This will output the structure of the AB1 like this

Header { hName = "ABIF" , hVersion = 101 }
Directory
  { dTagName = "tdir"
  , dTagNum = 1
  , dElemTypeCode = 1023
  , dElemTypeDesc = "root"
  , dElemType = ElemRoot
  , dElemSize = 28
  , dElemNum = 13
  , dDataSize = 364
  , dDataOffset = 61980
  , dData = ""
  , dDataDebug = []
  }
[ Directory
    { dTagName = "DATA"
    , dTagNum = 9
    , dElemTypeCode = 4
    , dElemTypeDesc = "short"
    , dElemType = ElemShort
    , dElemSize = 2
    , dElemNum = 7440
    , dDataSize = 14880
    , dDataOffset = 128
    , dData = ""
    , dDataDebug = []
    }
    
.
.
.

DATA {short} tagNum=9 size=2 count=7440 offset=128  []
DATA {short} tagNum=10 size=2 count=7440 offset=15008  []
DATA {short} tagNum=11 size=2 count=7440 offset=29888  []
DATA {short} tagNum=12 size=2 count=7440 offset=44768  []
FWO_ {char} tagNum=1 size=1 count=4 offset=1195463747  ["GATC"]
LANE {short} tagNum=1 size=2 count=1 offset=65536  ["1"]
PBAS {char} tagNum=1 size=1 count=744 offset=59648  ["GGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGA"]
PDMF {pString} tagNum=1 size=1 count=23 offset=60392  ["KB_3500_POP7_BDTv3.mob"]
PDMF {pString} tagNum=2 size=1 count=23 offset=60415  ["KB_3500_POP7_BDTv3.mob"]
PLOC {short} tagNum=1 size=2 count=744 offset=60438  []
S/N% {short} tagNum=1 size=2 count=4 offset=61926  []
SMPL {pString} tagNum=1 size=1 count=10 offset=61934  ["S17-SeqF1"]
CMNT {pString} tagNum=1 size=1 count=1 offset=61944  ["Generated by HyraxBio AB1 generator"]

The data is output twice. The first section is the detail, the second is the summary.

Selected data types have the "debug data" element populated. e.g. the PBAS (FASTA)

Generate minimal AB1s from FASTAs

To create an AB1 run

hyraxAbif-exe gen "./pathContainingFastas" "./pathForOutputAb1s"

This will create an AB1 per input FASTA

Input FASTA format

Each input data should have the following format

> weight
read
> weight
read
  • The weight is a numeric value between 0 and 1 that specifies the weight of the current read. No other header/name is allowed

  • The read is the set of input nucleotides, IUPAC ambiguity codes are supported (MRWSYKVHDBNX). A read can be single or multi-line

Weighted reads

  • The weigh of a read specifies the intensity of the peak from 0 to 1.
  • Weights for each position are added to a maximum of 1 per nucleotide
  • You can use _ as a "blank" nucleotide, in which only the nucleotides from other reads will be considered

For example

> 0.5
ACG
> 0.3
AAAA
> 1
__AC

Results in the following weighted nucleotide per position

  • 0: A (0.5 + 0.3)
  • 1: C (0.5), A (0.3)
  • 2: G (0.5), A (0.3 + 1 = 1)
  • 3: A (0.3), C (1)

Note that the reads do not need to be the same length.

Reverse reads

A weighted FASTA can represent a reverse read. To do this add a R suffix to the weight. The data you enter should be entered as if it was a forward read. This data will be complemented and reversed before writing to the ABIF


Example FASTA - single file

eg1.fasta

> 1
ACTG

Here there is a single FASTA with a single read with a weigh of 1 (100%). The chromatogram for this AB1 shows perfect traces for the input ACTG nucleotides


Example FASTA - two FASTA files

eg1.fasta

> 1
ACAG

eg2.fasta

> 1
ACTG

Two input FASTA files both with a weigh of 1. You can see in the second trace that the third nucleotide is a T (the trace is green). Exactly what the base-calling software (phred & recall etc) decide to call the base as depends on your settings and software choices.


Example FASTA - two FASTA files with different weights

eg1.fasta

> 1
ACAG

eg2.fasta

> 0.3
ACTG

Here the second fasta has a weight of 0.3 and you can see the traces are 30% of the height of the top ones.


Example FASTA - single FASTA with a mix

eg1.fasta

> 1
ACAG
> 0.3
ACTG

The single input FASTA has an AT mix at the third nucleotide. The first read has a weight of 1 and the second a weight of 0.3. Notice that the maximum weight is 1, e.g. the first A has the same intensity as the second even though the first one has the reads weighted both 1 and 0.3


Example FASTA - Multiple mixes

eg1.fasta

> 1
ACAG
> 0.3
_GT
> 0.2
_G


Using the modules

  • Hyrax.Abif: The core AB1 types
  • Hyrax.Abif.Fasta: A simple FASTA parser used when generating AB1s
  • Hyrax.Abif.Read: Module for parsing an existing AB1
  • Hyrax.Abif.Write: Module for writing a new AB1 file
  • Hyrax.Abif.Generate: Module for generating a minimal AB1 from a given FASTA input

For a detailed overview of the code see TODO and the haddock documentation TODO

For now the terminal app (Main.hs) serves as an example and the best starting point to understand the code

E.g. Add a comment to an existing AB1 file

import qualified Hyrax.Abif as H
import qualified Hyrax.Abif.Read as H
import qualified Hyrax.Abif.Write as H

addComment :: IO ()
addComment = do
  abif' <- H.readAbif "example.ab1"

  case abif' of
    Left e -> putText $ "error reading ABIF: " <> e
    Right abif -> do
      let modified = H.addDirectory abif $ H.mkComment "new comment"
      H.writeAbif "example.modified.ab1" modified

For additional examples see the Examples directory